[velosuare@penduick 01_QC]$ cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o trimmed.1.fastq.gz -p trimmed.2.fastq.gz F-TAG-QUALITY_PASSED_R1.fastq F-TAG-QUALITY_PASSED_R2.fastq This is cutadapt 1.9.1 with Python 2.7.11 Command line parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o trimmed.1.fastq.gz -p trimmed.2.fastq.gz F-TAG-QUALITY_PASSED_R1.fastq F-TAG-QUALITY_PASSED_R2.fastq Trimming 2 adapters with at most 10.0% errors in paired-end mode ... Finished in 2488.84 s (54 us/read; 1.11 M reads/minute). === Summary === Total read pairs processed: 45,879,906 Read 1 with adapter: 2,590,328 (5.6%) Read 2 with adapter: 1,790,374 (3.9%) Pairs written (passing filters): 45,879,906 (100.0%) Total basepairs processed: 13,763,971,800 bp Read 1: 6,881,985,900 bp Read 2: 6,881,985,900 bp Total written (filtered): 13,679,005,050 bp (99.4%) Read 1: 6,804,924,446 bp Read 2: 6,874,080,604 bp === First read: Adapter 1 === Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 34; Trimmed: 2590328 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3 Bases preceding removed adapters: A: 27.4% C: 13.2% G: 38.2% T: 17.5% none/other: 3.6% Overview of removed sequences length count expect max.err error counts 3 1544051 716873.5 0 1544051 4 192155 179218.4 0 192155 5 28786 44804.6 0 28786 6 7157 11201.1 0 7157 7 3963 2800.3 0 3963 8 3372 700.1 0 3372 9 3982 175.0 0 3310 672 10 4940 43.8 1 3059 1881 11 4141 10.9 1 2994 1147 12 3837 2.7 1 3020 817 13 3564 0.7 1 2812 752 14 3601 0.2 1 2839 762 15 3609 0.0 1 2837 772 16 3531 0.0 1 2828 703 17 3573 0.0 1 2818 755 18 3471 0.0 1 2764 693 14 19 3540 0.0 1 2758 725 57 20 4014 0.0 2 2750 617 647 21 3943 0.0 2 2706 629 608 22 3925 0.0 2 2709 622 594 23 3726 0.0 2 2610 537 579 24 3626 0.0 2 2529 600 497 25 3644 0.0 2 2509 616 519 26 3568 0.0 2 2478 646 444 27 3619 0.0 2 2562 578 472 7 28 3662 0.0 2 2552 600 495 15 29 3609 0.0 2 2480 590 494 45 30 3854 0.0 3 2318 583 447 506 31 3721 0.0 3 2318 505 399 499 32 3845 0.0 3 2388 554 399 504 33 3648 0.0 3 2261 574 387 426 34 3924 0.0 3 2462 595 431 436 35 3883 0.0 3 2347 604 480 452 36 3889 0.0 3 2349 635 481 424 37 3909 0.0 3 2362 623 480 444 38 3991 0.0 3 2411 605 487 488 39 4071 0.0 3 2380 688 513 490 40 4088 0.0 3 2452 637 478 521 41 4176 0.0 3 2450 724 555 447 42 4094 0.0 3 2303 691 562 538 43 4130 0.0 3 2361 690 579 500 44 4201 0.0 3 2389 682 567 563 45 4156 0.0 3 2386 687 574 509 46 4243 0.0 3 2363 744 563 573 47 4480 0.0 3 2531 780 618 551 48 4292 0.0 3 2445 727 588 532 49 4497 0.0 3 2509 799 618 571 50 4516 0.0 3 2527 751 644 594 51 4564 0.0 3 2548 826 608 582 52 4714 0.0 3 2563 894 650 607 53 4676 0.0 3 2588 855 644 589 54 4718 0.0 3 2533 899 689 597 55 4681 0.0 3 2536 859 678 608 56 4776 0.0 3 2584 886 698 608 57 4833 0.0 3 2655 880 699 599 58 5030 0.0 3 2707 976 712 635 59 5125 0.0 3 2814 928 686 697 60 5307 0.0 3 2945 946 756 660 61 5063 0.0 3 2788 926 708 641 62 5241 0.0 3 2870 959 732 680 63 5326 0.0 3 2866 1015 753 692 64 5508 0.0 3 2908 1120 811 669 65 5450 0.0 3 3032 1043 738 637 66 5492 0.0 3 3001 1083 754 654 67 5586 0.0 3 3052 1114 727 693 68 5834 0.0 3 3260 1055 793 726 69 5605 0.0 3 3007 1145 761 692 70 6050 0.0 3 3379 1159 834 678 71 5918 0.0 3 3352 1089 791 686 72 6218 0.0 3 3464 1218 804 732 73 6089 0.0 3 3407 1141 845 696 74 6307 0.0 3 3550 1150 872 735 75 6182 0.0 3 3456 1149 862 715 76 6358 0.0 3 3600 1153 877 728 77 6364 0.0 3 3569 1227 845 723 78 6601 0.0 3 3777 1226 880 718 79 6524 0.0 3 3747 1219 833 725 80 6861 0.0 3 3895 1286 876 804 81 6657 0.0 3 3753 1358 871 675 82 6997 0.0 3 3994 1293 962 748 83 7091 0.0 3 4078 1315 906 792 84 7108 0.0 3 4118 1321 950 719 85 7223 0.0 3 4305 1287 866 765 86 7337 0.0 3 4227 1420 954 736 87 7339 0.0 3 4268 1366 966 739 88 7652 0.0 3 4545 1367 976 764 89 7393 0.0 3 4450 1322 896 725 90 7715 0.0 3 4668 1361 934 752 91 7677 0.0 3 4713 1298 916 750 92 8119 0.0 3 4904 1465 959 791 93 7921 0.0 3 4893 1387 915 726 94 8148 0.0 3 5135 1386 913 714 95 8057 0.0 3 5137 1382 849 689 96 8131 0.0 3 5160 1403 863 705 97 7907 0.0 3 5073 1396 772 666 98 8334 0.0 3 5460 1367 841 666 99 7753 0.0 3 5249 1255 723 526 100 7864 0.0 3 5394 1213 702 555 101 7269 0.0 3 5195 1126 535 413 102 7413 0.0 3 5300 1085 547 481 103 6685 0.0 3 4951 964 456 314 104 6977 0.0 3 5173 964 505 335 105 6327 0.0 3 4855 834 390 248 106 6764 0.0 3 5156 932 394 282 107 6315 0.0 3 5025 773 335 182 108 6868 0.0 3 5434 813 405 216 109 6348 0.0 3 5196 741 252 159 110 6874 0.0 3 5590 773 338 173 111 6338 0.0 3 5325 663 227 123 112 6942 0.0 3 5806 728 272 136 113 6780 0.0 3 5878 635 201 66 114 7111 0.0 3 6121 686 215 89 115 6724 0.0 3 5973 547 133 71 116 7167 0.0 3 6326 597 180 64 117 6774 0.0 3 6167 485 93 29 118 7090 0.0 3 6426 517 113 34 119 7118 0.0 3 6530 486 86 16 120 7265 0.0 3 6658 494 93 20 121 7048 0.0 3 6544 429 62 13 122 7150 0.0 3 6627 456 56 11 123 6835 0.0 3 6464 327 40 4 124 6782 0.0 3 6375 357 42 8 125 6476 0.0 3 6130 310 26 10 126 6514 0.0 3 6176 302 29 7 127 6143 0.0 3 5793 321 25 4 128 6046 0.0 3 5742 285 15 4 129 5426 0.0 3 5194 211 19 2 130 5585 0.0 3 5323 243 16 3 131 4816 0.0 3 4560 242 10 4 132 4595 0.0 3 4365 208 18 4 133 3925 0.0 3 3741 170 12 2 134 3763 0.0 3 3598 155 9 1 135 3104 0.0 3 2950 143 10 1 136 2803 0.0 3 2699 93 9 2 137 2249 0.0 3 2159 81 9 138 1891 0.0 3 1816 68 7 139 1309 0.0 3 1250 50 7 2 140 1083 0.0 3 1046 36 1 141 650 0.0 3 615 28 6 1 142 475 0.0 3 452 23 143 200 0.0 3 194 3 3 144 88 0.0 3 82 6 145 41 0.0 3 38 1 2 146 16 0.0 3 14 1 1 147 6 0.0 3 5 1 148 5 0.0 3 4 0 0 1 149 9 0.0 3 6 2 0 1 150 94505 0.0 3 11 605 92180 1709 === Second read: Adapter 2 === Sequence: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT; Type: regular 3'; Length: 58; Trimmed: 1790374 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-58 bp: 5 Bases preceding removed adapters: A: 29.9% C: 12.5% G: 41.6% T: 16.1% none/other: 0.0% Overview of removed sequences length count expect max.err error counts 3 1434919 716873.5 0 1434919 4 189627 179218.4 0 189627 5 35416 44804.6 0 35416 6 8714 11201.1 0 8714 7 4823 2800.3 0 4823 8 3818 700.1 0 3818 9 4420 175.0 0 3532 888 10 5984 43.8 1 3299 2685 11 4933 10.9 1 3156 1777 12 4611 2.7 1 3140 1471 13 4132 0.7 1 2963 1169 14 4199 0.2 1 2930 1269 15 3765 0.0 1 2716 1049 16 3726 0.0 1 2677 1049 17 3676 0.0 1 2609 1067 18 3362 0.0 1 2420 915 27 19 3402 0.0 1 2423 965 14 20 4113 0.0 2 2375 813 925 21 3898 0.0 2 2305 807 786 22 3785 0.0 2 2189 876 720 23 3761 0.0 2 2256 790 715 24 3673 0.0 2 2154 796 723 25 3620 0.0 2 2120 801 699 26 3519 0.0 2 2112 708 699 27 3414 0.0 2 2051 680 682 1 28 3561 0.0 2 2082 725 645 109 29 3470 0.0 2 2023 768 638 41 30 3817 0.0 3 1898 682 605 632 31 3656 0.0 3 1789 626 587 654 32 3681 0.0 3 1799 612 593 677 33 3480 0.0 3 1667 663 569 581 34 3186 0.0 3 1 1829 716 640 35 2524 0.0 3 0 10 32 2482 36 1819 0.0 3 0 0 24 75 1720 37 1756 0.0 3 0 1 16 1691 48 38 2365 0.0 3 0 0 8 1700 657 39 1753 0.0 3 0 0 7 62 1684 40 1695 0.0 4 0 0 0 35 1660 41 99 0.0 4 0 0 0 1 98 42 89 0.0 4 0 0 0 1 88 43 51 0.0 4 0 0 0 2 49 44 60 0.0 4 0 0 0 0 60 45 2 0.0 4 0 0 0 0 2